Working in the Lee Lab, I’ve spent a great deal of time considering the roles of IL-2 and IL-15 in NK cell based cancer immunotherapy applications. Our new review explores the opportunities and challenges in applying these cytokines. Read here 👉 doi.org/10.4110/in.202…
Excited to have shared preliminary data at the Gotham NK cell meeting today. 🧑🔬
Excited to see this work, led by my friend Shelby and my mentor Dr. Seung-Hwan Lee, published. By modeling CAR NK cell therapy, they highlight both opportunities and challenges of this approach. Read here 👉sciencedirect.com/science/articl…
From all of us at Ensembl, we wish you holidays filled with "ATGGAACGCCGCATTATGGAAAACACCGCGAACGATCCGGAAGCGTGCGAA" May your celebrations be as perfectly in‑frame as your favourite gene.
Last Thursday was our 8th Annual Lab Coat Ceremony. First year PhD students and third year MSTP students received their lab coats, which marks the beginning of their journey in academic research. Congrats to our participating students! mshs.co/4mXKQd2
On Christmas Day 1984, Nobel Prize laureates Elizabeth Blackburn (left) and Carol Greider (right) discovered the first evidence for the enzyme telomerase, which affects the way our cells age. They were awarded the medicine prize, alongside Jack Szostak, in 2009. #NobelPrize
Thank you to the federal government for investing in BioCanRx under the Strategic Science Fund. This investment in Canadian #immunotherapies provides hope for patients that one day we can turn all cancers into curable diseases. Learn more about the SSF: canada.ca/en/innovation-…
Excited to announce the Cook Lab will be opening at the Ottawa Hospital Research Institute Jan 2024. We'll be focusing on intratumoural heterogeneity and therapy resistance in ovarian cancer Eager to work more with the ovarian cancer research community! cooklab.ca
Attending conferences like @BioCanRx’s #Summit4CI isn't just about learning—it's also about fostering collaboration that can transform healthcare. Together, we can find a cure for #CCA. 🤝💉🩺
News: NIH immunotherapy pioneer Steven Rosenberg awarded nation’s highest honor for technology and innovation bit.ly/406fbeJ
Thank you @notjusttourists for your generosity! We, at MERCI, greatly appreciate your help in coordinating this wheelchair donation to the Hospital Regional Puerto Vallarta, Mexico!
Congratulations to all our poster awardees!! 🎉🥳🎊
United States トレンド
- 1. Kash N/A
- 2. Tourette N/A
- 3. #AKOTSK N/A
- 4. Claressa N/A
- 5. Lakers N/A
- 6. #RHOP N/A
- 7. FBI Director N/A
- 8. #IndustryHBO N/A
- 9. #AKnightOfTheSevenKingdoms N/A
- 10. Pritchard N/A
- 11. #BaddiesUSA N/A
- 12. 960 SAT N/A
- 13. Kelly Price N/A
- 14. Celtics N/A
- 15. El Mencho N/A
- 16. Maekar N/A
- 17. Canadians N/A
- 18. México N/A
- 19. Puerto Vallarta N/A
- 20. Italy N/A
Something went wrong.
Something went wrong.