#irbscience search results
📜🔬"Endogenous interactomes of MFN1 and MFN2 provide novel insights into interorganelle communication and autophagy" 📰Published in #Autophagy ✍️Isabel Gordaliza-Alaguero, @AntonioZorzano et al. ➡️shorturl.at/mThnD 📌doi.org/10.1080/155486… #IRBScience
This discovery marks a step forward in the fight against resistance to cancer treatment. By targeting #PersisterCells, the likelihood of relapse could be reduced, thus improving patient prognosis. ➡️bit.ly/40xlXfl 📌DOI: 10.1158/0008-5472.CAN-24-0529 #IRBScience
🎥Watch Dr. Carla Garcia-Cabau (@carla_gc8), the first author of the study, along with Dr. @annabartomeu, explain the details of this research work. ▶️youtu.be/KPrxBSPQ03o #IRBScience
📢"H4K20me3-Mediated Repression of Inflammatory Genes Is a Characteristic and Targetable Vulnerability of Persister #Cancer Cells" 🗣️Explained by Dr. @ValentinaRampo5, first author 📰#CancerResearch @AACR ➡️shorturl.at/yo1zg 📌doi.org/10.1158/0008-5… #IRBScience
📌"Pas de gegant per entendre la causa de l'#autisme més comú" 📰@diariARA ✍️@saez_cristina ➡️shorturl.at/1Dztj #IRBScience #Autism @RMendezLab @xsalvatella @annabartomeu @carla_gc8
📌"Las 24 letras cruciales en el surgimiento del #autismo: GCAAGGACATATGGGCGAAGGAGA" 📰@el_pais ✍️ @manuelansede ➡️shorturl.at/HZQVh #IRBScience #Autism @RMendezLab @xsalvatella @annabartomeu @carla_gc8
📌"Científicos de Barcelona descubren un fallo en el cerebro que causa #autismo" 📰@LaVanguardia ✍️Josep Corbella ➡️shorturl.at/xsInl #IRBScience #Autism @RMendezLab @xsalvatella @annabartomeu @carla_gc8
🔬Identificat un nou escut de les cèl·lules tumorals persistents, clau per combatre la reaparició del #càncer. 📰 Catalunya Biomèdica ➡️tinyurl.com/wbvnzbva #IRBScience @ValentinaRampo5
📢 It´s finally here! I´m thrilled to announce the opening of the Pediatric Cancer Epigenetics lab at #IRBBarcelona and @IRSJD_info! 🎉 I'm overflowing with excitement to lead groundbreaking research aimed at helping pediatric cancer patients. #IRBScience #PCCB
🔬Identifiquen com les cèl·lules tumorals persistents es protegeixen de les teràpies oncològiques. 📰@LaVanguardia ➡️shorturl.at/k8RoJ #IRBScience #CancerResearch #Senescence
📢#NewPaper: "Defective Slc7a7 transport reduces erythropoietin compromising erythropoiesis." 📰Molecular Medicine ✍️ @SusBodoy, Manuel Palacín, @AntonioZorzano et al. ➡️tinyurl.com/prtsyz93 📌doi.org/10.1186/s10020… #IRBScience @iCERCA @_BIST @SOMM_alliance @PCB_UB
Very happy to be a part of this exciting work where we demonstrate how Chromosomal instability can cause DNA damage and further Tumor invasiveness. doi.org/10.1016/j.cub.… #IRBScience #DNADamage #Aneuploidy #Cancer #Tumors #Drosophila
🧬Chromosomal instability in #cancer cells causes DNA damage and promotes invasiveness. ✍️Dr. @MarcoMilanIRB (#IRBBarcelona-@icreacommunity) in @CurrentBiology 📌DOI: doi.org/10.1016/j.cub.… ➡️bit.ly/3ZspUzM #IRBScience 🧵👇
We are so lucky to have Toni and team at @IRBBarcelona!!🔥🔥🔥🔥 #IRBScience #WeAreIRB @URSAchemlab @EscaleRiera 👇
🤝 #MeetOurScientists: A journey behind the scenes at #IRBBarcelona! ⚗️ Introducing Dr. Antoni Riera, Group Leader of our Research Unit on Asymmetric Synthesis. 🎥Don't miss out on this video about his🔝research! #IRBScience #WeAreIRB @URSAchemlab @EscaleRiera
🔬Un plaer haver contribuït a aquest treball liderat per la @UniBarcelona que suposa un avenç important en l'àmbit de la neurologia. 📰 @CellStemCell 📌DOI:10.1016/j.stem.2024.09.013 #IRBScience #AgingResearch
#RecercaUB | 🧠 És possible revertir els efectes de l’envelliment en les neurones? Una recerca liderada per la #UniBarcelona descriu com la reprogramació cel·lular permet recuperar en ratolins algunes funcions neurològiques alterades. 🔬 Lideren l’estudi els investigadors…
Watch to learn more about @AznarLab's paradigm-shifting research discoveries at @IRBBarcelona👇 #IRBScience #ScienceThatInspires x.com/IRBBarcelona/s…
🗣️Dr. @SalvadorAznar3 recognized as one of the '50 Scientists that Inspire' by @CellPressNews! ▶️ Watch him share his thoughts on this recognition & reveal the groundbreaking moments that shaped his discoveries in #CancerResearch & #AgingResearch. 👇
🔬 Major advance in #AutismResearch: Dr. @carla_gc8 explains the key role of #CPEB4 condensates in autism. 🧠 This study, published in @Nature, opens new possibilities for targeted therapies. 📌 DOI: doi.org/10.1038/s41586… #IRBScience @annabartomeu @xsalvatella1 @RMendezLab
#PCBCommunity | Congrats @FranSupek & team! 👏🔝🤗 @ERC_Research @IRBBarcelona @icreacommunity #IRBScience #EUfunded #ERCCoG
📢#IRBBarcelona-@icreacommunity researcher Dr. @FranSupek receives an @ERC_Research Consolidator Grant to study #cancer and #aging-related DNA structural changes. 🔬The project has been awarded €2M to address structural variants. ➡️bit.ly/3XQqEx4 #ERCCoG #IRBScience
🔬Identificat un nou escut de les cèl·lules tumorals persistents, clau per combatre la reaparició del #càncer. 📰 Catalunya Biomèdica ➡️tinyurl.com/wbvnzbva #IRBScience @ValentinaRampo5
📢#NewPaper: "Defective Slc7a7 transport reduces erythropoietin compromising erythropoiesis." 📰Molecular Medicine ✍️ @SusBodoy, Manuel Palacín, @AntonioZorzano et al. ➡️tinyurl.com/prtsyz93 📌doi.org/10.1186/s10020… #IRBScience @iCERCA @_BIST @SOMM_alliance @PCB_UB
📢"H4K20me3-Mediated Repression of Inflammatory Genes Is a Characteristic and Targetable Vulnerability of Persister #Cancer Cells" 🗣️Explained by Dr. @ValentinaRampo5, first author 📰#CancerResearch @AACR ➡️shorturl.at/yo1zg 📌doi.org/10.1158/0008-5… #IRBScience
🔬Identifiquen com les cèl·lules tumorals persistents es protegeixen de les teràpies oncològiques. 📰@LaVanguardia ➡️shorturl.at/k8RoJ #IRBScience #CancerResearch #Senescence
This discovery marks a step forward in the fight against resistance to cancer treatment. By targeting #PersisterCells, the likelihood of relapse could be reduced, thus improving patient prognosis. ➡️bit.ly/40xlXfl 📌DOI: 10.1158/0008-5472.CAN-24-0529 #IRBScience
📜🔬"Endogenous interactomes of MFN1 and MFN2 provide novel insights into interorganelle communication and autophagy" 📰Published in #Autophagy ✍️Isabel Gordaliza-Alaguero, @AntonioZorzano et al. ➡️shorturl.at/mThnD 📌doi.org/10.1080/155486… #IRBScience
📜🔬"Endogenous interactomes of MFN1 and MFN2 provide novel insights into interorganelle communication and autophagy" 📰Published in #Autophagy ✍️Isabel Gordaliza-Alaguero, @AntonioZorzano et al. ➡️shorturl.at/mThnD 📌doi.org/10.1080/155486… #IRBScience
🔬 Major advance in #AutismResearch: Dr. @carla_gc8 explains the key role of #CPEB4 condensates in autism. 🧠 This study, published in @Nature, opens new possibilities for targeted therapies. 📌 DOI: doi.org/10.1038/s41586… #IRBScience @annabartomeu @xsalvatella1 @RMendezLab
📌"Científicos de Barcelona descubren un fallo en el cerebro que causa #autismo" 📰@LaVanguardia ✍️Josep Corbella ➡️shorturl.at/xsInl #IRBScience #Autism @RMendezLab @xsalvatella @annabartomeu @carla_gc8
📌"Pas de gegant per entendre la causa de l'#autisme més comú" 📰@diariARA ✍️@saez_cristina ➡️shorturl.at/1Dztj #IRBScience #Autism @RMendezLab @xsalvatella @annabartomeu @carla_gc8
📌"Las 24 letras cruciales en el surgimiento del #autismo: GCAAGGACATATGGGCGAAGGAGA" 📰@el_pais ✍️ @manuelansede ➡️shorturl.at/HZQVh #IRBScience #Autism @RMendezLab @xsalvatella @annabartomeu @carla_gc8
🎥Watch Dr. Carla Garcia-Cabau (@carla_gc8), the first author of the study, along with Dr. @annabartomeu, explain the details of this research work. ▶️youtu.be/KPrxBSPQ03o #IRBScience
🔬Un plaer haver contribuït a aquest treball liderat per la @UniBarcelona que suposa un avenç important en l'àmbit de la neurologia. 📰 @CellStemCell 📌DOI:10.1016/j.stem.2024.09.013 #IRBScience #AgingResearch
#RecercaUB | 🧠 És possible revertir els efectes de l’envelliment en les neurones? Una recerca liderada per la #UniBarcelona descriu com la reprogramació cel·lular permet recuperar en ratolins algunes funcions neurològiques alterades. 🔬 Lideren l’estudi els investigadors…
Watch to learn more about @AznarLab's paradigm-shifting research discoveries at @IRBBarcelona👇 #IRBScience #ScienceThatInspires x.com/IRBBarcelona/s…
🗣️Dr. @SalvadorAznar3 recognized as one of the '50 Scientists that Inspire' by @CellPressNews! ▶️ Watch him share his thoughts on this recognition & reveal the groundbreaking moments that shaped his discoveries in #CancerResearch & #AgingResearch. 👇
🔬Scientists at #IRBBarcelona (@LudersLab) & @CNIOStopCancer (@LlorcaLab) reveal how the protein CDK5RAP2 activates a key process that helps cells organize their internal structure. 📰@Dev_Cell ➡️bit.ly/48cezYX 📌DOI: 10.1016/j.devcel.2024.09.001 #IRBScience
🗣️Dr. @SalvadorAznar3 (#IRBBarcelona-@icreacommunity), experto en #envejecimiento: “No hay alimentos malos en sí, hasta el azúcar y la grasa son necesarias”. 📰@infobae ➡️shorturl.at/Ae6kA #IRBScience @AznarLab @icreacommunity
🔬💊Cinc factors clau prediuen la resposta a la immunoteràpia en pacients amb #càncer. 👉Aquests resultats ofereixen un marc per millorar la medicina personalitzada del càncer. 📰Publicat a @NatureGenet ➡️shorturl.at/fwAps 📌DOI: 10.1038/s41588-024-01899-0 #IRBScience…
🗣️Dr. @SalvadorAznar3 (#IRBBarcelona-@icreacommunity), experto en #envejecimiento: “No hay alimentos malos en sí, hasta el azúcar y la grasa son necesarias”. 📰@infobae ➡️shorturl.at/Ae6kA #IRBScience
🔬Scientists at #IRBBarcelona (@LudersLab) & @CNIOStopCancer (@LlorcaLab) reveal how the protein CDK5RAP2 activates a key process that helps cells organize their internal structure. 📰@Dev_Cell ➡️bit.ly/48cezYX 📌DOI: 10.1016/j.devcel.2024.09.001 #IRBScience
📜🔬"Endogenous interactomes of MFN1 and MFN2 provide novel insights into interorganelle communication and autophagy" 📰Published in #Autophagy ✍️Isabel Gordaliza-Alaguero, @AntonioZorzano et al. ➡️shorturl.at/mThnD 📌doi.org/10.1080/155486… #IRBScience
📌"Pas de gegant per entendre la causa de l'#autisme més comú" 📰@diariARA ✍️@saez_cristina ➡️shorturl.at/1Dztj #IRBScience #Autism @RMendezLab @xsalvatella @annabartomeu @carla_gc8
🔬💊Cinc factors clau prediuen la resposta a la immunoteràpia en pacients amb #càncer. 👉Aquests resultats ofereixen un marc per millorar la medicina personalitzada del càncer. 📰Publicat a @NatureGenet ➡️shorturl.at/fwAps 📌DOI: 10.1038/s41588-024-01899-0 #IRBScience…
This discovery marks a step forward in the fight against resistance to cancer treatment. By targeting #PersisterCells, the likelihood of relapse could be reduced, thus improving patient prognosis. ➡️bit.ly/40xlXfl 📌DOI: 10.1158/0008-5472.CAN-24-0529 #IRBScience
🎥Watch Dr. Carla Garcia-Cabau (@carla_gc8), the first author of the study, along with Dr. @annabartomeu, explain the details of this research work. ▶️youtu.be/KPrxBSPQ03o #IRBScience
📌"Las 24 letras cruciales en el surgimiento del #autismo: GCAAGGACATATGGGCGAAGGAGA" 📰@el_pais ✍️ @manuelansede ➡️shorturl.at/HZQVh #IRBScience #Autism @RMendezLab @xsalvatella @annabartomeu @carla_gc8
🔬Identificat un nou escut de les cèl·lules tumorals persistents, clau per combatre la reaparició del #càncer. 📰 Catalunya Biomèdica ➡️tinyurl.com/wbvnzbva #IRBScience @ValentinaRampo5
📌"Científicos de Barcelona descubren un fallo en el cerebro que causa #autismo" 📰@LaVanguardia ✍️Josep Corbella ➡️shorturl.at/xsInl #IRBScience #Autism @RMendezLab @xsalvatella @annabartomeu @carla_gc8
🗣️Dr. @SalvadorAznar3 (#IRBBarcelona-@icreacommunity), experto en #envejecimiento: “No hay alimentos malos en sí, hasta el azúcar y la grasa son necesarias”. 📰@infobae ➡️shorturl.at/Ae6kA #IRBScience @AznarLab @icreacommunity
🔬Identifiquen com les cèl·lules tumorals persistents es protegeixen de les teràpies oncològiques. 📰@LaVanguardia ➡️shorturl.at/k8RoJ #IRBScience #CancerResearch #Senescence
📢#NewPaper: "Defective Slc7a7 transport reduces erythropoietin compromising erythropoiesis." 📰Molecular Medicine ✍️ @SusBodoy, Manuel Palacín, @AntonioZorzano et al. ➡️tinyurl.com/prtsyz93 📌doi.org/10.1186/s10020… #IRBScience @iCERCA @_BIST @SOMM_alliance @PCB_UB
Something went wrong.
Something went wrong.
United States Trends
- 1. #UFC322 38.5K posts
- 2. Ewing 5,703 posts
- 3. Bama 19.2K posts
- 4. Wellmaker 4,031 posts
- 5. Oklahoma 29.3K posts
- 6. Noah Thomas N/A
- 7. #AEWCollision 4,789 posts
- 8. Wingo 1,324 posts
- 9. Arch 17.7K posts
- 10. Ty Simpson 3,850 posts
- 11. Jeremiah Smith 2,087 posts
- 12. Bronny 5,110 posts
- 13. Boomer Sooner 2,173 posts
- 14. #GoDawgs 5,166 posts
- 15. Georgia 79K posts
- 16. UConn 4,746 posts
- 17. Iowa 20.1K posts
- 18. Sabatini 1,386 posts
- 19. Shapen N/A
- 20. Lagway 1,274 posts