#irbscience search results

📜🔬"Endogenous interactomes of MFN1 and MFN2 provide novel insights into interorganelle communication and autophagy" 📰Published in #Autophagy ✍️Isabel Gordaliza-Alaguero, @AntonioZorzano et al. ➡️shorturl.at/mThnD 📌doi.org/10.1080/155486… #IRBScience

IRBBarcelona's tweet image. 📜🔬"Endogenous interactomes of MFN1 and MFN2 provide novel insights into interorganelle communication and autophagy"

📰Published in #Autophagy

✍️Isabel Gordaliza-Alaguero, @AntonioZorzano et al.

➡️shorturl.at/mThnD

📌doi.org/10.1080/155486…

#IRBScience

This discovery marks a step forward in the fight against resistance to cancer treatment. By targeting #PersisterCells, the likelihood of relapse could be reduced, thus improving patient prognosis. ➡️bit.ly/40xlXfl 📌DOI: 10.1158/0008-5472.CAN-24-0529 #IRBScience

IRBBarcelona's tweet image. This discovery marks a step forward in the fight against resistance to cancer treatment. By targeting #PersisterCells, the likelihood of relapse could be reduced, thus improving patient prognosis.

➡️bit.ly/40xlXfl

📌DOI: 10.1158/0008-5472.CAN-24-0529

#IRBScience

🎥Watch Dr. Carla Garcia-Cabau (@carla_gc8), the first author of the study, along with Dr. @annabartomeu, explain the details of this research work. ▶️youtu.be/KPrxBSPQ03o #IRBScience

IRBBarcelona's tweet image. 🎥Watch Dr. Carla Garcia-Cabau (@carla_gc8), the first author of the study, along with Dr. @annabartomeu, explain the details of this research work.

▶️youtu.be/KPrxBSPQ03o

#IRBScience

📢"H4K20me3-Mediated Repression of Inflammatory Genes Is a Characteristic and Targetable Vulnerability of Persister #Cancer Cells" 🗣️Explained by Dr. @ValentinaRampo5, first author 📰#CancerResearch @AACR ➡️shorturl.at/yo1zg 📌doi.org/10.1158/0008-5… #IRBScience


📌"Las 24 letras cruciales en el surgimiento del #autismo: GCAAGGACATATGGGCGAAGGAGA" 📰@el_pais ✍️ @manuelansede ➡️shorturl.at/HZQVh #IRBScience #Autism @RMendezLab @xsalvatella @annabartomeu @carla_gc8

IRBBarcelona's tweet image. 📌"Las 24 letras cruciales en el surgimiento del #autismo: GCAAGGACATATGGGCGAAGGAGA"

📰@el_pais 

✍️ @manuelansede

➡️shorturl.at/HZQVh

#IRBScience #Autism @RMendezLab @xsalvatella @annabartomeu @carla_gc8

📌"Científicos de Barcelona descubren un fallo en el cerebro que causa #autismo" 📰@LaVanguardia ✍️Josep Corbella ➡️shorturl.at/xsInl #IRBScience #Autism @RMendezLab @xsalvatella @annabartomeu @carla_gc8

IRBBarcelona's tweet image. 📌"Científicos de Barcelona descubren un fallo en el cerebro que causa #autismo"

📰@LaVanguardia 

✍️Josep Corbella

➡️shorturl.at/xsInl

#IRBScience #Autism @RMendezLab @xsalvatella @annabartomeu @carla_gc8

🔬Identificat un nou escut de les cèl·lules tumorals persistents, clau per combatre la reaparició del #càncer. 📰 Catalunya Biomèdica ➡️tinyurl.com/wbvnzbva #IRBScience @ValentinaRampo5

IRBBarcelona's tweet image. 🔬Identificat un nou escut de les cèl·lules tumorals persistents, clau per combatre la reaparició del #càncer.

📰 Catalunya Biomèdica

➡️tinyurl.com/wbvnzbva

#IRBScience @ValentinaRampo5

📢 It´s finally here! I´m thrilled to announce the opening of the Pediatric Cancer Epigenetics lab at #IRBBarcelona and @IRSJD_info! 🎉 I'm overflowing with excitement to lead groundbreaking research aimed at helping pediatric cancer patients. #IRBScience #PCCB


🔬Identifiquen com les cèl·lules tumorals persistents es protegeixen de les teràpies oncològiques. 📰@LaVanguardia ➡️shorturl.at/k8RoJ #IRBScience #CancerResearch #Senescence

IRBBarcelona's tweet image. 🔬Identifiquen com les cèl·lules tumorals persistents es protegeixen de les teràpies oncològiques.

📰@LaVanguardia 

➡️shorturl.at/k8RoJ

#IRBScience #CancerResearch #Senescence

📢#NewPaper: "Defective Slc7a7 transport reduces erythropoietin compromising erythropoiesis." 📰Molecular Medicine ✍️ @SusBodoy, Manuel Palacín, @AntonioZorzano et al. ➡️tinyurl.com/prtsyz93 📌doi.org/10.1186/s10020… #IRBScience @iCERCA @_BIST @SOMM_alliance @PCB_UB

IRBBarcelona's tweet image. 📢#NewPaper: "Defective Slc7a7 transport reduces erythropoietin compromising erythropoiesis."

📰Molecular Medicine

✍️ @SusBodoy, Manuel Palacín, @AntonioZorzano et al.

➡️tinyurl.com/prtsyz93

📌doi.org/10.1186/s10020…

#IRBScience @iCERCA @_BIST  @SOMM_alliance @PCB_UB

Very happy to be a part of this exciting work where we demonstrate how Chromosomal instability can cause DNA damage and further Tumor invasiveness. doi.org/10.1016/j.cub.… #IRBScience #DNADamage #Aneuploidy #Cancer #Tumors #Drosophila

🧬Chromosomal instability in #cancer cells causes DNA damage and promotes invasiveness. ✍️Dr. @MarcoMilanIRB (#IRBBarcelona-@icreacommunity) in @CurrentBiology 📌DOI: doi.org/10.1016/j.cub.… ➡️bit.ly/3ZspUzM #IRBScience 🧵👇

IRBBarcelona's tweet image. 🧬Chromosomal instability in #cancer cells causes DNA damage and promotes invasiveness.

✍️Dr. @MarcoMilanIRB (#IRBBarcelona-@icreacommunity) in @CurrentBiology

📌DOI: doi.org/10.1016/j.cub.…

➡️bit.ly/3ZspUzM

#IRBScience

🧵👇


We are so lucky to have Toni and team at @IRBBarcelona!!🔥🔥🔥🔥 #IRBScience #WeAreIRB @URSAchemlab @EscaleRiera 👇

🤝 #MeetOurScientists: A journey behind the scenes at #IRBBarcelona! ⚗️ Introducing Dr. Antoni Riera, Group Leader of our Research Unit on Asymmetric Synthesis. 🎥Don't miss out on this video about his🔝research! #IRBScience #WeAreIRB @URSAchemlab @EscaleRiera



🔬Un plaer haver contribuït a aquest treball liderat per la @UniBarcelona que suposa un avenç important en l'àmbit de la neurologia. 📰 @CellStemCell 📌DOI:10.1016/j.stem.2024.09.013 #IRBScience #AgingResearch

#RecercaUB | 🧠 És possible revertir els efectes de l’envelliment en les neurones? Una recerca liderada per la #UniBarcelona descriu com la reprogramació cel·lular permet recuperar en ratolins algunes funcions neurològiques alterades. 🔬 Lideren l’estudi els investigadors…

UniBarcelona's tweet image. #RecercaUB | 🧠 És possible revertir els efectes de l’envelliment en les neurones?

Una recerca liderada per la #UniBarcelona descriu com la reprogramació cel·lular permet recuperar en ratolins algunes funcions neurològiques alterades.

🔬 Lideren l’estudi els investigadors…


Watch to learn more about @AznarLab's paradigm-shifting research discoveries at @IRBBarcelona👇 #IRBScience #ScienceThatInspires x.com/IRBBarcelona/s…

🗣️Dr. @SalvadorAznar3 recognized as one of the '50 Scientists that Inspire' by @CellPressNews! ▶️ Watch him share his thoughts on this recognition & reveal the groundbreaking moments that shaped his discoveries in #CancerResearch & #AgingResearch. 👇



🔬 Major advance in #AutismResearch: Dr. @carla_gc8 explains the key role of #CPEB4 condensates in autism. 🧠 This study, published in @Nature, opens new possibilities for targeted therapies. 📌 DOI: doi.org/10.1038/s41586… #IRBScience @annabartomeu @xsalvatella1 @RMendezLab


📢#IRBBarcelona-@icreacommunity researcher Dr. @FranSupek receives an @ERC_Research Consolidator Grant to study #cancer and #aging-related DNA structural changes. 🔬The project has been awarded €2M to address structural variants. ➡️bit.ly/3XQqEx4 #ERCCoG #IRBScience

IRBBarcelona's tweet image. 📢#IRBBarcelona-@icreacommunity researcher Dr. @FranSupek receives an @ERC_Research Consolidator Grant to study #cancer and #aging-related DNA structural changes.

🔬The project has been awarded €2M to address structural variants.

➡️bit.ly/3XQqEx4

#ERCCoG #IRBScience


🔬Identificat un nou escut de les cèl·lules tumorals persistents, clau per combatre la reaparició del #càncer. 📰 Catalunya Biomèdica ➡️tinyurl.com/wbvnzbva #IRBScience @ValentinaRampo5

IRBBarcelona's tweet image. 🔬Identificat un nou escut de les cèl·lules tumorals persistents, clau per combatre la reaparició del #càncer.

📰 Catalunya Biomèdica

➡️tinyurl.com/wbvnzbva

#IRBScience @ValentinaRampo5

📢#NewPaper: "Defective Slc7a7 transport reduces erythropoietin compromising erythropoiesis." 📰Molecular Medicine ✍️ @SusBodoy, Manuel Palacín, @AntonioZorzano et al. ➡️tinyurl.com/prtsyz93 📌doi.org/10.1186/s10020… #IRBScience @iCERCA @_BIST @SOMM_alliance @PCB_UB

IRBBarcelona's tweet image. 📢#NewPaper: "Defective Slc7a7 transport reduces erythropoietin compromising erythropoiesis."

📰Molecular Medicine

✍️ @SusBodoy, Manuel Palacín, @AntonioZorzano et al.

➡️tinyurl.com/prtsyz93

📌doi.org/10.1186/s10020…

#IRBScience @iCERCA @_BIST  @SOMM_alliance @PCB_UB

📢"H4K20me3-Mediated Repression of Inflammatory Genes Is a Characteristic and Targetable Vulnerability of Persister #Cancer Cells" 🗣️Explained by Dr. @ValentinaRampo5, first author 📰#CancerResearch @AACR ➡️shorturl.at/yo1zg 📌doi.org/10.1158/0008-5… #IRBScience


🔬Identifiquen com les cèl·lules tumorals persistents es protegeixen de les teràpies oncològiques. 📰@LaVanguardia ➡️shorturl.at/k8RoJ #IRBScience #CancerResearch #Senescence

IRBBarcelona's tweet image. 🔬Identifiquen com les cèl·lules tumorals persistents es protegeixen de les teràpies oncològiques.

📰@LaVanguardia 

➡️shorturl.at/k8RoJ

#IRBScience #CancerResearch #Senescence

This discovery marks a step forward in the fight against resistance to cancer treatment. By targeting #PersisterCells, the likelihood of relapse could be reduced, thus improving patient prognosis. ➡️bit.ly/40xlXfl 📌DOI: 10.1158/0008-5472.CAN-24-0529 #IRBScience

IRBBarcelona's tweet image. This discovery marks a step forward in the fight against resistance to cancer treatment. By targeting #PersisterCells, the likelihood of relapse could be reduced, thus improving patient prognosis.

➡️bit.ly/40xlXfl

📌DOI: 10.1158/0008-5472.CAN-24-0529

#IRBScience

📜🔬"Endogenous interactomes of MFN1 and MFN2 provide novel insights into interorganelle communication and autophagy" 📰Published in #Autophagy ✍️Isabel Gordaliza-Alaguero, @AntonioZorzano et al. ➡️shorturl.at/mThnD 📌doi.org/10.1080/155486… #IRBScience

IRBBarcelona's tweet image. 📜🔬"Endogenous interactomes of MFN1 and MFN2 provide novel insights into interorganelle communication and autophagy"

📰Published in #Autophagy

✍️Isabel Gordaliza-Alaguero, @AntonioZorzano et al.

➡️shorturl.at/mThnD

📌doi.org/10.1080/155486…

#IRBScience

📜🔬"Endogenous interactomes of MFN1 and MFN2 provide novel insights into interorganelle communication and autophagy" 📰Published in #Autophagy ✍️Isabel Gordaliza-Alaguero, @AntonioZorzano et al. ➡️shorturl.at/mThnD 📌doi.org/10.1080/155486… #IRBScience

IRBBarcelona's tweet image. 📜🔬"Endogenous interactomes of MFN1 and MFN2 provide novel insights into interorganelle communication and autophagy"

📰Published in #Autophagy

✍️Isabel Gordaliza-Alaguero, @AntonioZorzano et al.

➡️shorturl.at/mThnD

📌doi.org/10.1080/155486…

#IRBScience

🔬 Major advance in #AutismResearch: Dr. @carla_gc8 explains the key role of #CPEB4 condensates in autism. 🧠 This study, published in @Nature, opens new possibilities for targeted therapies. 📌 DOI: doi.org/10.1038/s41586… #IRBScience @annabartomeu @xsalvatella1 @RMendezLab


📌"Científicos de Barcelona descubren un fallo en el cerebro que causa #autismo" 📰@LaVanguardia ✍️Josep Corbella ➡️shorturl.at/xsInl #IRBScience #Autism @RMendezLab @xsalvatella @annabartomeu @carla_gc8

IRBBarcelona's tweet image. 📌"Científicos de Barcelona descubren un fallo en el cerebro que causa #autismo"

📰@LaVanguardia 

✍️Josep Corbella

➡️shorturl.at/xsInl

#IRBScience #Autism @RMendezLab @xsalvatella @annabartomeu @carla_gc8

📌"Las 24 letras cruciales en el surgimiento del #autismo: GCAAGGACATATGGGCGAAGGAGA" 📰@el_pais ✍️ @manuelansede ➡️shorturl.at/HZQVh #IRBScience #Autism @RMendezLab @xsalvatella @annabartomeu @carla_gc8

IRBBarcelona's tweet image. 📌"Las 24 letras cruciales en el surgimiento del #autismo: GCAAGGACATATGGGCGAAGGAGA"

📰@el_pais 

✍️ @manuelansede

➡️shorturl.at/HZQVh

#IRBScience #Autism @RMendezLab @xsalvatella @annabartomeu @carla_gc8

🎥Watch Dr. Carla Garcia-Cabau (@carla_gc8), the first author of the study, along with Dr. @annabartomeu, explain the details of this research work. ▶️youtu.be/KPrxBSPQ03o #IRBScience

IRBBarcelona's tweet image. 🎥Watch Dr. Carla Garcia-Cabau (@carla_gc8), the first author of the study, along with Dr. @annabartomeu, explain the details of this research work.

▶️youtu.be/KPrxBSPQ03o

#IRBScience

🔬Un plaer haver contribuït a aquest treball liderat per la @UniBarcelona que suposa un avenç important en l'àmbit de la neurologia. 📰 @CellStemCell 📌DOI:10.1016/j.stem.2024.09.013 #IRBScience #AgingResearch

#RecercaUB | 🧠 És possible revertir els efectes de l’envelliment en les neurones? Una recerca liderada per la #UniBarcelona descriu com la reprogramació cel·lular permet recuperar en ratolins algunes funcions neurològiques alterades. 🔬 Lideren l’estudi els investigadors…

UniBarcelona's tweet image. #RecercaUB | 🧠 És possible revertir els efectes de l’envelliment en les neurones?

Una recerca liderada per la #UniBarcelona descriu com la reprogramació cel·lular permet recuperar en ratolins algunes funcions neurològiques alterades.

🔬 Lideren l’estudi els investigadors…


Watch to learn more about @AznarLab's paradigm-shifting research discoveries at @IRBBarcelona👇 #IRBScience #ScienceThatInspires x.com/IRBBarcelona/s…

🗣️Dr. @SalvadorAznar3 recognized as one of the '50 Scientists that Inspire' by @CellPressNews! ▶️ Watch him share his thoughts on this recognition & reveal the groundbreaking moments that shaped his discoveries in #CancerResearch & #AgingResearch. 👇



🔬Scientists at #IRBBarcelona (@LudersLab) & @CNIOStopCancer (@LlorcaLab) reveal how the protein CDK5RAP2 activates a key process that helps cells organize their internal structure. 📰@Dev_Cell ➡️bit.ly/48cezYX 📌DOI: 10.1016/j.devcel.2024.09.001 #IRBScience

IRBBarcelona's tweet image. 🔬Scientists at #IRBBarcelona (@LudersLab) & @CNIOStopCancer (@LlorcaLab) reveal how the protein CDK5RAP2 activates a key process that helps cells organize their internal structure.

📰@Dev_Cell

➡️bit.ly/48cezYX
 
📌DOI: 10.1016/j.devcel.2024.09.001

#IRBScience

🗣️Dr. @SalvadorAznar3 (#IRBBarcelona-@icreacommunity), experto en #envejecimiento: “No hay alimentos malos en sí, hasta el azúcar y la grasa son necesarias”. 📰@infobae ➡️shorturl.at/Ae6kA #IRBScience @AznarLab @icreacommunity

IRBBarcelona's tweet image. 🗣️Dr. @SalvadorAznar3 (#IRBBarcelona-@icreacommunity), experto en #envejecimiento: “No hay alimentos malos en sí, hasta el azúcar y la grasa son necesarias”.

📰@infobae

➡️shorturl.at/Ae6kA

#IRBScience @AznarLab @icreacommunity

🔬💊Cinc factors clau prediuen la resposta a la immunoteràpia en pacients amb #càncer. 👉Aquests resultats ofereixen un marc per millorar la medicina personalitzada del càncer. 📰Publicat a @NatureGenet ➡️shorturl.at/fwAps 📌DOI: 10.1038/s41588-024-01899-0 #IRBScience

IRBBarcelona's tweet image. 🔬💊Cinc factors clau prediuen la resposta a la immunoteràpia en pacients amb #càncer.

👉Aquests resultats ofereixen un marc per millorar la medicina personalitzada del càncer.

📰Publicat a @NatureGenet

➡️shorturl.at/fwAps

📌DOI: 10.1038/s41588-024-01899-0

#IRBScience…

🗣️Dr. @SalvadorAznar3 (#IRBBarcelona-@icreacommunity), experto en #envejecimiento: “No hay alimentos malos en sí, hasta el azúcar y la grasa son necesarias”. 📰@infobae ➡️shorturl.at/Ae6kA #IRBScience

IRBBarcelona's tweet image. 🗣️Dr. @SalvadorAznar3 (#IRBBarcelona-@icreacommunity), experto en #envejecimiento: “No hay alimentos malos en sí, hasta el azúcar y la grasa son necesarias”.

📰@infobae

➡️shorturl.at/Ae6kA

#IRBScience

No results for "#irbscience"

🔬Scientists at #IRBBarcelona (@LudersLab) & @CNIOStopCancer (@LlorcaLab) reveal how the protein CDK5RAP2 activates a key process that helps cells organize their internal structure. 📰@Dev_Cell ➡️bit.ly/48cezYX 📌DOI: 10.1016/j.devcel.2024.09.001 #IRBScience

IRBBarcelona's tweet image. 🔬Scientists at #IRBBarcelona (@LudersLab) & @CNIOStopCancer (@LlorcaLab) reveal how the protein CDK5RAP2 activates a key process that helps cells organize their internal structure.

📰@Dev_Cell

➡️bit.ly/48cezYX
 
📌DOI: 10.1016/j.devcel.2024.09.001

#IRBScience

📜🔬"Endogenous interactomes of MFN1 and MFN2 provide novel insights into interorganelle communication and autophagy" 📰Published in #Autophagy ✍️Isabel Gordaliza-Alaguero, @AntonioZorzano et al. ➡️shorturl.at/mThnD 📌doi.org/10.1080/155486… #IRBScience

IRBBarcelona's tweet image. 📜🔬"Endogenous interactomes of MFN1 and MFN2 provide novel insights into interorganelle communication and autophagy"

📰Published in #Autophagy

✍️Isabel Gordaliza-Alaguero, @AntonioZorzano et al.

➡️shorturl.at/mThnD

📌doi.org/10.1080/155486…

#IRBScience

🔬💊Cinc factors clau prediuen la resposta a la immunoteràpia en pacients amb #càncer. 👉Aquests resultats ofereixen un marc per millorar la medicina personalitzada del càncer. 📰Publicat a @NatureGenet ➡️shorturl.at/fwAps 📌DOI: 10.1038/s41588-024-01899-0 #IRBScience

IRBBarcelona's tweet image. 🔬💊Cinc factors clau prediuen la resposta a la immunoteràpia en pacients amb #càncer.

👉Aquests resultats ofereixen un marc per millorar la medicina personalitzada del càncer.

📰Publicat a @NatureGenet

➡️shorturl.at/fwAps

📌DOI: 10.1038/s41588-024-01899-0

#IRBScience…

This discovery marks a step forward in the fight against resistance to cancer treatment. By targeting #PersisterCells, the likelihood of relapse could be reduced, thus improving patient prognosis. ➡️bit.ly/40xlXfl 📌DOI: 10.1158/0008-5472.CAN-24-0529 #IRBScience

IRBBarcelona's tweet image. This discovery marks a step forward in the fight against resistance to cancer treatment. By targeting #PersisterCells, the likelihood of relapse could be reduced, thus improving patient prognosis.

➡️bit.ly/40xlXfl

📌DOI: 10.1158/0008-5472.CAN-24-0529

#IRBScience

🎥Watch Dr. Carla Garcia-Cabau (@carla_gc8), the first author of the study, along with Dr. @annabartomeu, explain the details of this research work. ▶️youtu.be/KPrxBSPQ03o #IRBScience

IRBBarcelona's tweet image. 🎥Watch Dr. Carla Garcia-Cabau (@carla_gc8), the first author of the study, along with Dr. @annabartomeu, explain the details of this research work.

▶️youtu.be/KPrxBSPQ03o

#IRBScience

📌"Las 24 letras cruciales en el surgimiento del #autismo: GCAAGGACATATGGGCGAAGGAGA" 📰@el_pais ✍️ @manuelansede ➡️shorturl.at/HZQVh #IRBScience #Autism @RMendezLab @xsalvatella @annabartomeu @carla_gc8

IRBBarcelona's tweet image. 📌"Las 24 letras cruciales en el surgimiento del #autismo: GCAAGGACATATGGGCGAAGGAGA"

📰@el_pais 

✍️ @manuelansede

➡️shorturl.at/HZQVh

#IRBScience #Autism @RMendezLab @xsalvatella @annabartomeu @carla_gc8

🔬Identificat un nou escut de les cèl·lules tumorals persistents, clau per combatre la reaparició del #càncer. 📰 Catalunya Biomèdica ➡️tinyurl.com/wbvnzbva #IRBScience @ValentinaRampo5

IRBBarcelona's tweet image. 🔬Identificat un nou escut de les cèl·lules tumorals persistents, clau per combatre la reaparició del #càncer.

📰 Catalunya Biomèdica

➡️tinyurl.com/wbvnzbva

#IRBScience @ValentinaRampo5

📌"Científicos de Barcelona descubren un fallo en el cerebro que causa #autismo" 📰@LaVanguardia ✍️Josep Corbella ➡️shorturl.at/xsInl #IRBScience #Autism @RMendezLab @xsalvatella @annabartomeu @carla_gc8

IRBBarcelona's tweet image. 📌"Científicos de Barcelona descubren un fallo en el cerebro que causa #autismo"

📰@LaVanguardia 

✍️Josep Corbella

➡️shorturl.at/xsInl

#IRBScience #Autism @RMendezLab @xsalvatella @annabartomeu @carla_gc8

🗣️Dr. @SalvadorAznar3 (#IRBBarcelona-@icreacommunity), experto en #envejecimiento: “No hay alimentos malos en sí, hasta el azúcar y la grasa son necesarias”. 📰@infobae ➡️shorturl.at/Ae6kA #IRBScience @AznarLab @icreacommunity

IRBBarcelona's tweet image. 🗣️Dr. @SalvadorAznar3 (#IRBBarcelona-@icreacommunity), experto en #envejecimiento: “No hay alimentos malos en sí, hasta el azúcar y la grasa son necesarias”.

📰@infobae

➡️shorturl.at/Ae6kA

#IRBScience @AznarLab @icreacommunity

🔬Identifiquen com les cèl·lules tumorals persistents es protegeixen de les teràpies oncològiques. 📰@LaVanguardia ➡️shorturl.at/k8RoJ #IRBScience #CancerResearch #Senescence

IRBBarcelona's tweet image. 🔬Identifiquen com les cèl·lules tumorals persistents es protegeixen de les teràpies oncològiques.

📰@LaVanguardia 

➡️shorturl.at/k8RoJ

#IRBScience #CancerResearch #Senescence

📢#NewPaper: "Defective Slc7a7 transport reduces erythropoietin compromising erythropoiesis." 📰Molecular Medicine ✍️ @SusBodoy, Manuel Palacín, @AntonioZorzano et al. ➡️tinyurl.com/prtsyz93 📌doi.org/10.1186/s10020… #IRBScience @iCERCA @_BIST @SOMM_alliance @PCB_UB

IRBBarcelona's tweet image. 📢#NewPaper: "Defective Slc7a7 transport reduces erythropoietin compromising erythropoiesis."

📰Molecular Medicine

✍️ @SusBodoy, Manuel Palacín, @AntonioZorzano et al.

➡️tinyurl.com/prtsyz93

📌doi.org/10.1186/s10020…

#IRBScience @iCERCA @_BIST  @SOMM_alliance @PCB_UB

Loading...

Something went wrong.


Something went wrong.


United States Trends